PSMA2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52356-CF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All PSMA2 Reagents

CRO Services

Product recommended


All PSMA2 Reagents

PSMA2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
705 bp
Description
Full length Clone DNA of Mouse proteasome (prosome, macropain) subunit, alpha type 2 with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PSMA2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names

Lmpc3 cDNA ORF Clone, Mouse

PSMA2 Background Information

Full Name
proteasome (prosome, macropain) subunit, alpha type, 2

PSMA2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PSMA2 cDNA ORF Clone in Cloning Vector, Rat RG81499-G

PSMA2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PSMA2 cDNA ORF Clone in Cloning Vector, Mouse MG52356-G
PSMA2 cDNA ORF Clone, Mouse, untagged MG52356-UT
PSMA2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52356-ACGLN
PSMA2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52356-ACG
PSMA2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52356-ANG
PSMA2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52356-ACR
PSMA2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52356-ANR
PSMA2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52356-NF
PSMA2 cDNA ORF Clone, Mouse, C-His tag MG52356-CH
PSMA2 cDNA ORF Clone, Mouse, N-His tag MG52356-NH
PSMA2 cDNA ORF Clone, Mouse, C-HA tag MG52356-CY
PSMA2 cDNA ORF Clone, Mouse, N-HA tag MG52356-NY
PSMA2 cDNA ORF Clone, Mouse, C-Myc tag MG52356-CM
PSMA2 cDNA ORF Clone, Mouse, N-Myc tag MG52356-NM
PSMA2 qPCR Primer Pairs, Mouse MP202229

PSMA2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PSMA2 cDNA ORF Clone in Cloning Vector, Human HG15155-G
PSMA2 cDNA ORF Clone, Human, untagged HG15155-UT
PSMA2 cDNA ORF Clone, Human, C-GFPSpark® tag HG15155-ACG
PSMA2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15155-ACGLN
PSMA2 cDNA ORF Clone, Human, N-GFPSpark® tag HG15155-ANG
PSMA2 cDNA ORF Clone, Human, C-OFPSpark® tag HG15155-ACR
PSMA2 cDNA ORF Clone, Human, N-OFPSpark® tag HG15155-ANR
PSMA2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15155-CF
PSMA2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15155-NF
PSMA2 cDNA ORF Clone, Human, C-His tag HG15155-CH
PSMA2 cDNA ORF Clone, Human, N-His tag HG15155-NH
PSMA2 cDNA ORF Clone, Human, C-HA tag HG15155-CY
PSMA2 cDNA ORF Clone, Human, N-HA tag HG15155-NY
PSMA2 cDNA ORF Clone, Human, C-Myc tag HG15155-CM
PSMA2 cDNA ORF Clone, Human, N-Myc tag HG15155-NM
PSMA2 qPCR Primer Pairs, Human HP103782
info info
添加购物车成功! 添加购物车失败!