Commande rapide

Souris SHP2 / PTPN11 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse PTPN11 Informations sur les produits clonés de cDNA
Taille du ADNc:1782bp
Description du ADNc:Full length Clone DNA of Mus musculus protein tyrosine phosphatase, non-receptor type 11, transcript variant 2 with N terminal Flag tag.
Synonyme du gène:Syp, Shp2, PTP1D, PTP2C, SAP-2, SHP-2, SH-PTP2, SH-PTP3
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Souris SHP2 / PTPN11 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur on other vectors
Souris SHP2 / PTPN11 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurMG50462-ACGCHF290
Souris SHP2 / PTPN11 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurMG50462-ACRCHF290
Souris SHP2 / PTPN11 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurMG50462-ANGCHF290
Souris SHP2 / PTPN11 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurMG50462-ANRCHF290
Souris SHP2 / PTPN11 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurMG50462-CFCHF260
Souris SHP2 / PTPN11 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurMG50462-CHCHF260
Souris SHP2 / PTPN11 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurMG50462-CMCHF260
Souris SHP2 / PTPN11 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurMG50462-CYCHF260
Souris SHP2 / PTPN11 transcript variant 2 Gène ADNc clone le vecteur de clonageMG50462-MCHF90
Souris SHP2 / PTPN11 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurMG50462-NFCHF260
Souris SHP2 / PTPN11 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurMG50462-NHCHF260
Souris SHP2 / PTPN11 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurMG50462-NMCHF260
Souris SHP2 / PTPN11 transcript variant 2 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurMG50462-NYCHF260
Souris SHP2 / PTPN11 transcript variant 2 expression plasmide de Gène l'ADNc ORF cloneMG50462-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

SHP2, also known as PTPN11, belongs to the protein-tyrosine phosphatase(PTP) family, non-receptor class 2 subfamily. PTPs catalyze the removal of phosphate groups from tyrosine residues by the hydrolysis of phosphoric acid monoesters. They dephosphorylate EGFR, JAK2 and TYK2 kinases, promoting oncogenic transformation. SHP2 is widely expressed, with highest levels in heart, brain, and skeletal muscle. SHP2 acts downstream of various receptor and cytoplasmic protein tyrosine kinases to participate in the signal transduction from the cell surface to the nucleus. It also dephosphorylates ROCK2 at Tyr-722 resulting in stimulatation of its RhoA binding activity.

  • Ganju R K, et al. (2000) Beta-chemokine receptor CCR5 signals through SHP1, SHP2, and Syk. J Biol Chem. 275(23):17263-8.
  • Yin T, et al. (1997) Molecular characterization of specific interactions between SHP-2 phosphatase and JAK tyrosine kinases. J Biol Chem. 272(2):1032-7.
  • Kontaridis MI, et al. (2006) PTPN11 (Shp2) mutations in LEOPARD syndrome have dominant negative, not activating, effects. J Biol Chem. 281(10):6785-92.
  • Size / Price
    Catalogue : MG50462-NF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.