After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Souris PTPN2/TC-PTP expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse PTPN2 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_001127177.1
Taille du ADNc:1221bp
Description du ADNc:Full length Clone DNA of Mus musculus protein tyrosine phosphatase, non-receptor type 2 with N terminal Myc tag.
Synonyme du gène:Ptpt, TC-PTP, AI325124, Ptpn2
Espèces:Mouse
Vecteur:pCMV3-SP-N-Myc
Plasmid:
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Fond

Tyrosine-protein phosphatase non-receptor type 2, also known as T-cell protein-tyrosine phosphatase, PTPN2 and PTPT, is a cytoplasm protein which belongs to the protein-tyrosine phosphatase family and Non-receptor class 1 subfamily. Members of the protein tyrosine phosphatase ( PTP ) family share a highly conserved catalytic motif, which is essential for the catalytic activity. TC-PTP / PTPN2 is a cytosolic tyrosine phosphatase that functions as a negative regulator of a variety of tyrosine kinases and other signaling proteins. The expression of TC-PTP / PTPN2 plays a role of tumor suppressor and may modulate response to treatment. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. Epidermal growth factor receptor and the adaptor protein Shc were reported to be substrates of this PTP, which suggested the roles in growth factor mediated cell signaling. TC-PTP / PTPN2 is an enzyme that is essential for the proper functioning of the immune system and that participates in the control of cell proliferation, and inflammation. TC-PTP / PTPN2 was identified as a negative regulator of NUP214-ABL1 kinase activity.

All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »