Pleiotrophin cDNA ORF Clone, Mouse, C-Myc tag

Price:
Size:
Number:

Pleiotrophin cDNA ORF Clone, Mouse, C-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
507 bp
Description
Full length Clone DNA of Mouse pleiotrophin with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Pleiotrophin cDNA ORF Clone, Mouse, C-Myc tag: Alternative Names

HARP cDNA ORF Clone, Mouse; HB-GAM cDNA ORF Clone, Mouse; HBBN cDNA ORF Clone, Mouse; HBGF-8 cDNA ORF Clone, Mouse; HBNF cDNA ORF Clone, Mouse; OSF cDNA ORF Clone, Mouse; Osf-1 cDNA ORF Clone, Mouse; Osf1 cDNA ORF Clone, Mouse

Pleiotrophin Background Information

HB-GAM belongs to the pleiotrophin family. During embryonic and early postnatal development, HB-GAM is expressed in the central and peripheral nervous system and also in several non-neural tissues, notably lung, kidney, gut and bone. While in the adult central nervous system, it is expressed in an activity-dependent manner in the hippocampus where it can suppress long term potentiation induction. HB-GAM has a low expression in other areas of the adult brain, but it can be induced by ischemic insults, or targeted neuronal damaged in the entorhinal cortex or in the substantia nigra pars compacta. It is structurally related to midkine and retinoic acid induced heparin-binding protein and has a high affinity for heparin. HB-GAM binds anaplastic lymphoma kinase (ALK) which induces MAPK pathway activation, an important step in the anti-apoptotic signaling of PTN and regulation of cell proliferation. It also functions as a secreted growth factor and induces neurite outgrowth and which is mitogenic for fibroblasts, epithelial, and endothelial cells.
Full Name
pleiotrophin
References
  • Vanderwinden JM, et al. (1992) Cellular distribution of the new growth factor pleiotrophin (HB-GAM) mRNA in developing and adult rat tissues. Anat Embryol. 186(4):387-406.
  • Lauri SE, et al. (1996) Activity-induced enhancement of HB-GAM expression in rat hippocampal slices. Neuroreport. 7(10):1670-4.
  • Pavlov I, et al. (2002) Role of heparin-binding growth-associated molecule (HB-GAM) in hippocampal LTP and spatial learning revealed by studies on overexpressing and knockout mice. Mol Cell Neurosci. 20(2):330-42.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait