Commande rapide

Souris RAC2 expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse RAC2 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_009008.3
Taille du ADNc:579bp
Description du ADNc:Full length Clone DNA of Mus musculus RAS-related C3 botulinum substrate 2 with C terminal Myc tag.
Synonyme du gène:AI323801, AI452260
Espèces:Mouse
Vecteur:pCMV3-C-Myc
Plasmid:
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Fond

Ras-related C3 botulinum toxin substrate 2 (Rac2) is a small G-protein belonging to the Ras subfamily of the GTPase family. Rac2 acts as an "on / off" switch for signal transduction cascades and motilities. When GDP is attached to the small G-protein, the enzyme is inactivated. Release of the GDP and replace of the GTP cativate the GTPasee. Rac2 remains active until the GTP is hydrolyzed to GDP. Rac2 is a hematopoietic-specific Rho family GTPase implicated as an important constituent of the NADPH oxidase complex and shares 92% amino acid identity with the ubiquitously expressed Rac1. The small G-protein Rac2 regulates the rearrangements of actin and membrane necessary for Fcy receptor-mediated phagocytosis by macrophages. Activated Rac2 binds to the p21-binding domain of PAK1 and this binding provided a basis for microscopic methods to localize activation of these G proteins inside cells.

Références
  • Adam D, et al. (2003) Cdc42, Rac1, and Rac2 Display Distinct Patterns of Activation during Phagocytosis.Mol Biol Cell. 15 (8 ): 3509-19.
  • Walmsley MJ, et al. (2003) Critical Roles for Rac1 and Rac2 GTPases in B Cell Development and Signaling. Science. 302 (5644): 459-62.
  • Holland M, et al. (2011) RAC2, AEP, and ICAM1 expression are associated with CNS disease in a mouse model of pre-B childhood acute lymphoblastic leukemia. Blood. 118 (3): 638-49.
  • Size / Price
    Catalogue : MG52761-CM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »