Commande rapide

Souris Renin expression plasmide de Gène l'ADNc ORF clone

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Souris REN Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:NM_031192.3
    Taille du ADNc:1209bp
    Description du ADNc:Full length Clone DNA of Mus musculus renin 2 tandem duplication of Ren1.
    Synonyme du gène:Ren, Rnr, Rn-2, Ren-2, Ren-B, Ren2
    Espèces:Mouse
    Vecteur:pCMV3-untagged
    Plasmid:
    Site de restriction:
    Séquence du marqueur:
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with REN qPCR primers for gene expression analysis, MP200303 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    Fond

    Renin-1, also known as Ren-1, Angiotensinogenase and Kidney renin, is a member of the peptidase A1 family. Renin-1 is synthesized by the juxtaglomerular cells of the kidney in response to decreased blood pressure and sodium concentration. androgen and thyroid hormones influence levels of Renin-1 in mouse submandibular gland (SMG) primarily by regulating the amount of Renin-1 mRNA available for translation. Renin-1 is a highly specific endopeptidase, whose only known function is to generate angiotensin I from angiotensinogen in the plasma, initiating a cascade of reactions that produce an elevation of blood pressure and increased sodium retention by the kidney. It is expressed at relatively low levels in mouse SMG and kidney. Ren-2 is expressed at high levels in the mouse SMG and at very low levels, if at all, in the kidney. Ren-1 and Ren-2 are closely linked on mouse chromosome 1, show extensive homology in coding and noncoding regions and provide a model for studying the regulation of gene expression.

    Size / Price
    Catalogue : MG50279-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »