RNF41 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Price:
Size:
Number:

RNF41 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
954 bp
Description
Full length Clone DNA of Mouse ring finger protein 41 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

RNF41 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag: Alternative Names

2210404G21Rik cDNA ORF Clone, Mouse; 4930511A05Rik cDNA ORF Clone, Mouse; 4933415P08Rik cDNA ORF Clone, Mouse; D10Ertd722e cDNA ORF Clone, Mouse; FLRF cDNA ORF Clone, Mouse; Nrdp1 cDNA ORF Clone, Mouse

RNF41 Background Information

Full Name
ring finger protein 41, E3 ubiquitin protein ligase
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait