After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Souris ROBO4 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse ROBO4 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_028783.2
Taille du ADNc:3048bp
Description du ADNc:Full length Clone DNA of Mus musculus roundabout homolog 4 (Drosophila) with N terminal Flag tag.
Synonyme du gène:AI593217, 1200012D01Rik, Robo4
Espèces:Mouse
Vecteur:pCMV3-SP-N-FLAG
Plasmid:
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Fond

Roundabout homolog 4, also known as magic roundabout and ROBO4 is a member of the immunoglobulin superfamily and ROBO family. ROBO4 is specifically expressed in endothelial cells. It is expressed at sites of angiogenesis in different tumor types. ROBO4 contains two fibronectin type-III domains and two Ig-like C2-type (immunoglobulin-like) domains. ROBO4 is the fourth identified member of the roundabout receptor family. It is the only Robo family member expressed in primary endothelial cells and that application of Slit inhibits their migration. ROBO4 is predominantly expressed in embryonic or tumor vascular endothelium and is considered important for vascular development and as a candidate tumor endothelial marker. ROBO4 is a bona fide member of the Robo family and may provide a repulsive cue to migrating endothelial cells during vascular development. ROBO4 is a receptor for Slit proteins, at least for SLIT2, and seems to be involved in angiogenesis and vascular patterning. ROBO4 may mediate the inhibition of primary endothelial cell migration by Slit proteins. Activating ROBO4 may have broad therapeutic application in diseases characterized by excessive angiogenesis and/or vascular leak.

Références
  • Huminiecki L., et al., 2002, Genomics 79:547-552.
  • Park,K.W. et al., 2003,Dev Biol. 261 (1):251-67.
  • Yoshikawa,M. et al., 2008, Protein Expr Purif. 61 (1):78-82.
  • Jones,C.A. et al., 2008, Nat Med. 14 (4):448-53.
  • Koch,A.W. et al., 2011, Dev Cell. 20 (1):33-46.
  • Size / Price
    Catalogue : MG51081-NF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »