Commande rapide

Text Size:AAA

Souris ROGDI expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Souris ROGDI Informations sur les produits clonés de cDNA
    Taille du ADNc:864bp
    Description du ADNc:Full length Clone DNA of Mus musculus rogdi homolog (Drosophila) with N terminal HA tag.
    Synonyme du gène:Lzf, C76152, AU020118, 0610011C19Rik
    Site de restriction:
    Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Description de la séquence:
    ( We provide with ROGDI qPCR primers for gene expression analysis, MP201879 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Size / Price
    Catalogue : MG52006-NY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.