After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Souris FTLS / RSPO2 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse RSPO2 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_172815.3
Taille du ADNc:732bp
Description du ADNc:Full length Clone DNA of Mus musculus R-spondin 2 homolog with C terminal His tag.
Synonyme du gène:ftls, AA673245
Espèces:Mouse
Vecteur:pCMV3-C-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Fond

R-spondin-2, also known as RSPO2, synergizes with Wnt to activate beta-catenin. RSPO2 is secreted proteins that regulate beta-catenin signaling. Activator of the beta-catenin signaling cascade leads to TCF-dependent gene activation. Action both in the canonical Wnt / beta- catenin-dependent pathway, possibly via a direct interaction with Wnt proteins, and in a Wnt-independent beta catenin pathway through a receptor signaling pathway that may not use frizzled / LRP receptors. Probably also acts as a ligand for frizzled and LRP receptors. The encoding gene Rspo2 was identified as a novel common integration site for the mouse mammary tumor virus in viral induced mouse mammary tumors. Rspo2 and Rspo2 / Wnt1 tumors contained many spindle cells, consistent with an epithelial-mesenchymal transformation phenotype. When Rspo2 and Rspo2 / Wnt1 tumor cells were transferred into naive mice, they exhibited greater metastatic activity than cells derived from Wnt1 tumors.

Références
  • Cadieu E, et al. (2009) Coat Variation in the Domestic Dog Is Governed by Variants in Three Genes. Science. 326: 150-153.
  • Kazanskaya O, et al. (2004) R-Spondin2 is a secreted activator of Wnt / beta-catenin signaling and is required for Xenopus myogenesis. Dev Cell. 7(4): 525-34.
  • Parker HG, et al. (2010) An insertion in the RSPO2 gene correlates with improper coat in the Portuguese water dog. J Hered. 101(5):612-7.
  • Size / Price
    Catalogue : MG51078-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »