SR-BI / SCARB1 cDNA ORF Clone, Mouse, C-Myc tag

1/1
Price:
Size:
Number:

SR-BI / SCARB1 cDNA ORF Clone, Mouse, C-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1530 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse scavenger receptor class B, member 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 1.58kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SR-BI / SCARB1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SR-BI / SCARB1 cDNA ORF Clone, Mouse, C-Myc tag: Validated Images

SR-BI / SCARB1 cDNA ORF Clone, Mouse, C-Myc tag: Alternative Names

AI120173 cDNA ORF Clone, Mouse; CD36 cDNA ORF Clone, Mouse; Cd36l1 cDNA ORF Clone, Mouse; Cla-1 cDNA ORF Clone, Mouse; Cla1 cDNA ORF Clone, Mouse; D5Ertd460e cDNA ORF Clone, Mouse; Hdlq1 cDNA ORF Clone, Mouse; Hlb398 cDNA ORF Clone, Mouse; mSR-BI cDNA ORF Clone, Mouse; SR-B1 cDNA ORF Clone, Mouse; SR-BI cDNA ORF Clone, Mouse; Srb1 cDNA ORF Clone, Mouse; SRBI cDNA ORF Clone, Mouse

SR-BI / SCARB1 Background Information

Scavenger receptor class B, member 1 (SCARB1), also known as CD36L1, is a member of the scavenger receptor family. SCARB1 is expressed primarily in liver and non placental steroidogenic tissues, and predominantly localized to cholesterol and sphingomyelin-enriched domains within the plasma membrane. SCARB1 is proposed as a receptor for different ligands such as phospholipids, cholesterol ester, lipoproteins, phosphatidylserine and apoptotic cells, and is involved in a wide variety of physilogical processes. As a key component in the reverse cholesterol transport pathway, SCARB1 binds high density lipoproteins (HDLs) and mediates selective cholesterol uptake by a mechanism distinct from the LDL pathway.High density lipoproteins (HDLs) play a critical role in cholesterol metabolism and their plasma concentrations are inversely correlated with risk for atherosclerosis. SCARB1 may thus serve as a useful marker that predicts variation in baseline lipid levels and postprandial lipid response. The mouse SCARB1 has been shown to exert actions in determining the levels of plasma lipoprotein cholesterol and the accumulation of cholesterol stores in the adrenal gland.
Full Name
scavenger receptor class B, member 1
References
  • Murao, K. et al., 1997, J. Biol. Chem. 272(28): 17551-17557.
  • Ikemoto, M. et al., 2000, Proc. Natl. Acad. Sci. U.S.A. 97 (12): 6538-6543.
  • Husemann, J. et al., 2001, Am. J. Pathol. 158 (3): 825-832. 
  • Williams, D.L. et al., 2001, Endocr. Res. 26 (4): 639-651.
  • Bulte, B. S. et al., 2002, J. Biol. Chem. 277 (39): 36092-36099.
  • Duncan, K.G. et al., 2002, Biochem. Biophys. Res. Commun. 292 (4): 1017-1022. 

SR-BI / SCARB1 cDNA ORF Clone, Rat, Related Products

Add to Cart Successfully Add to Cart Failed