SDHB cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52752-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SDHB Reagents
CRO Services
Product recommended

All SDHB Reagents
SDHB cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
849 bp
Description
Full length Clone DNA of Mouse succinate dehydrogenase complex, subunit B, iron sulfur (Ip) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SDHB cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
0710008N11Rik cDNA ORF Clone, Mouse
SDHB Background Information
Full Name
succinate dehydrogenase complex, subunit B, iron sulfur (Ip)

SDHB cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SDHB cDNA ORF Clone in Cloning Vector, Rat RG80772-U
SDHB cDNA ORF Clone, Rat, untagged RG80772-UT
SDHB cDNA ORF Clone, Rat, C-GFPSpark® tag RG80772-ACG
SDHB Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80772-ACGLN
SDHB cDNA ORF Clone, Rat, N-GFPSpark® tag RG80772-ANG
SDHB cDNA ORF Clone, Rat, C-OFPSpark® tag RG80772-ACR
SDHB cDNA ORF Clone, Rat, N-OFPSpark® tag RG80772-ANR
SDHB cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80772-CF
SDHB cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80772-NF
SDHB cDNA ORF Clone, Rat, C-His tag RG80772-CH
SDHB cDNA ORF Clone, Rat, N-His tag RG80772-NH
SDHB cDNA ORF Clone, Rat, C-HA tag RG80772-CY
SDHB cDNA ORF Clone, Rat, N-HA tag RG80772-NY
SDHB cDNA ORF Clone, Rat, C-Myc tag RG80772-CM
SDHB cDNA ORF Clone, Rat, N-Myc tag RG80772-NM
SDHB qPCR Primer Pairs, Rat RP300736

SDHB cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SDHB cDNA ORF Clone in Cloning Vector, Mouse MG52752-G
SDHB cDNA ORF Clone, Mouse, untagged MG52752-UT
SDHB Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52752-ACGLN
SDHB cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52752-ACG
SDHB cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52752-ANG
SDHB cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52752-ACR
SDHB cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52752-ANR
SDHB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52752-CF
SDHB cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52752-NF
SDHB cDNA ORF Clone, Mouse, C-His tag MG52752-CH
SDHB cDNA ORF Clone, Mouse, N-His tag MG52752-NH
SDHB cDNA ORF Clone, Mouse, C-HA tag MG52752-CY
SDHB cDNA ORF Clone, Mouse, N-HA tag MG52752-NY
SDHB cDNA ORF Clone, Mouse, C-Myc tag MG52752-CM

SDHB cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SDHB cDNA ORF Clone in Cloning Vector, Human HG17794-U
info info
添加购物车成功! 添加购物车失败!