Commande rapide

Souris P-Selectin/CD62P/SELP expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse SELP Informations sur les produits clonés de cDNA
Taille du ADNc:2307bp
Description du ADNc:Full length Clone DNA of Mus musculus selectin, platelet with N terminal His tag.
Synonyme du gène:Grmp, CD62P, PADGEM, MGC129336, MGC129337, P-selectin, Selp
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name

P selectin (SELP) is a 140kDa protein that is stored in the alpha-granules of platelets and Weibel-Palade bodies of endothelial cells. SELP mediates rapid rolling of leukocyte rolling over vascular surfaces during the initial steps in inflammation through interaction with PSGL1. P selectin is a cell adhesion molecule on the surface of activated endothelial cells. Cellular adhesion molecules are a large family of proteins that attach the cytoskeleton and intracellular signaling cascades with the extracellular environment. SELP is a calcium-dependent receptor for myeloid cells that binds to sialylated forms of Lewis blood group carbohydrate antigens on neutrophils and monocytes. This protein redistributes to the plasma membrane during platelet activation and degranulation and mediates the interacton of activated endothelial cells or platelets with leukocytes.

  • Johnson-Tidey RR, et al. (1994) Increase in the adhesion molecule P-selectin in endothelium overlying atherosclerotic plaques. Coexpression with intercellular adhesion molecule-1. Am J Pathol. 144(5):952-61.
  • Walcheck B, et al. (1996) Neutrophil-neutrophil interactions under hydrodynamic shear stress involve L-selectin and PSGL-1. A mechanism that amplifies initial leukocyte accumulation of P-selectin in vitro. J Clin Invest. 98(5):1081-7.
  • Foreman KE, et al. (1994) C5a-induced expression of P-selectin in endothelial cells. J Clin Invest. 94(3):1147-55.
  • Size / Price
    Catalogue : MG50737-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.