Commande rapide

Souris Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse SEMA4A Informations sur les produits clonés de cDNA
Taille du ADNc:2283bp
Description du ADNc:Full length Clone DNA of Mus musculus sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A, transcript variant 1 with C terminal Myc tag.
Synonyme du gène:SemB, Semab, AI132332, Sema4a
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Souris Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur on other vectors
Souris Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurMG50330-ACGCHF290
Souris Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurMG50330-ACRCHF290
Souris Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurMG50330-CFCHF260
Souris Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurMG50330-CHCHF260
Souris Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurMG50330-CMCHF260
Souris Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurMG50330-CYCHF260
Souris Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 Gène ADNc clone le vecteur de clonageMG50330-MCHF90
Souris Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurMG50330-NFCHF260
Souris Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurMG50330-NHCHF260
Souris Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurMG50330-NMCHF260
Souris Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurMG50330-NYCHF260
Souris Semaphorin 4A/SEMA4A/Semaphorin B transcript variant 1 expression plasmide de Gène l'ADNc ORF cloneMG50330-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Semaphorin-4A, also known as Semaphorin-B, SEMA4A, Sema B and SEMAB, is a single-pass type I  membrane protein which belongs to the semaphorin family. It inhibits axonal extension by providing local signals to specify territories inaccessible for growing axons. Semaphorin-4A / SEMA4A contains one Ig-like C2-type (immunoglobulin-like) domain, one PSI domain and one Sema domain. Defects in SEMA4A are the cause of retinitis pigmentosa type 35 (RP35) which leads to degeneration of retinal photoreceptor cells. Patients typically have night vision blindness and loss of midperipheral visual field. As their condition progresses, they lose their far peripheral visual field and eventually central vision as well. Defects in SEMA4A are also the cause of cone-rod dystrophy type 10 (CORD10) which are inherited retinal dystrophies belonging to the group of pigmentary retinopathies. CORDs are characterized by retinal pigment deposits visible on fundus examination, predominantly in the macular region, and initial loss of cone photoreceptors followed by rod degeneration.

Semaphorins are secreted, transmembrane, and GPI-linked proteins, defined by cysteine-rich semaphorin protein domains, that have important roles in a variety of tissues. Humans have 20 semaphorins, Drosophila has five, and two are known from DNA viruses. Semaphorins are found in nematodes and crustaceans but not in non-animals. They are grouped into eight classes on the basis of phylogenetic tree analyses and the presence of additional protein motifs. Semaphorins have been implicated in diverse developmental processes such as axon guidance during nervous system development and regulation of cell migration.

  • Clark H.F., et al., 2003, Genome Res. 13: 2265-2270.
  • Ota T., et al., 2004,Nat. Genet. 36: 40-45.
  • Neufeld, G. et al., 2005, Front Biosci. 10 : 751-60.
  • Fiore,R. et al., 2005, Mol Cell Biol. 25 (6):2310-9.
  • Abid A., et al., 2006, J. Med. Genet. 43:378-381.
  • Size / Price
    Catalogue : MG50330-CM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.