Commande rapide

Text Size:AAA

Souris Antithrombin III/ATIII expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse SERPINC1 Informations sur les produits clonés de cDNA
Taille du ADNc:1398bp
Description du ADNc:Full length Clone DNA of Mus musculus serine (or cysteine) peptidase inhibitor, clade C (antithrombin), member 1 with N terminal Flag tag.
Synonyme du gène:At3, At-3, ATIII, AI114908
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Souris Antithrombin III/ATIII expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur on other vectors
Souris Antithrombin III/ATIII expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurMG52927-ACGCHF270
Souris Antithrombin III/ATIII expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurMG52927-ACRCHF270
Souris Antithrombin III/ATIII expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurMG52927-ANGCHF270
Souris Antithrombin III/ATIII expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurMG52927-ANRCHF270
Souris Antithrombin III/ATIII expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurMG52927-CFCHF230
Souris Antithrombin III/ATIII expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurMG52927-CHCHF230
Souris Antithrombin III/ATIII expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurMG52927-CMCHF230
Souris Antithrombin III/ATIII expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurMG52927-CYCHF230
Souris Antithrombin III/ATIII Gène ADNc clone le vecteur de clonageMG52927-GCHF90
Souris Antithrombin III/ATIII expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurMG52927-NFCHF230
Souris Antithrombin III/ATIII expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurMG52927-NHCHF230
Souris Antithrombin III/ATIII expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurMG52927-NMCHF230
Souris Antithrombin III/ATIII expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurMG52927-NYCHF230
Souris Antithrombin III/ATIII expression plasmide de Gène l'ADNc ORF cloneMG52927-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

SerpinC1, also known as antithrombin III (AT III), is a member of the serpin superfamily of serine protease inhibitors, and has been found to be a marker for disseminated intravascular coagulation (DIC) and to be of prognostic significance in septic patients. SerpinC1 synthesized in the liver is the principal plasma serpin of blood coagulation proteases and inhibits thrombin and other factors such as Xa by the formation of covalently linked complexes. Thus it is one of the most important coagulation inhibitors and the fundamental enzyme for the therapeutical action of heparin. In common with SerpinA5 and D1, the inhibitory activity of SerpinC1 undergoes a dramatic increase in the presence of heparin and other glycosaminoglycans. ATIII mediates the promotion of prostaglandin release, an inhibitor of leucocyte activation and downregulator of many proinflammatory cytokines. Antithrombin III exerts anti-inflammatory properties in addition to its anti-coagulative mechanisms. In animal models of sepsis, ATIII affected cytokine plasma concentrations with a decrease of pro-inflammatory cytokines. The deficiency or functional abnormality of ATIII may result in an increased risk of thromboembolic disease, such as deep vein thrombosis and pulmonary embolism. In addition, it has been reported that SerpinC1 can alter or influence inflammatory processes via inhibition of NF-κB activation or actin polymerization.

  • de Sousa JC, et al. (1991) Antithrombin III. Physiologic, physiopathologic and laboratory aspects. Rev Port Cardiol. 10(9): 693-9.
  • Totzke G, et al. (2001) Antithrombin III enhances inducible nitric oxide synthase gene expression in vascular smooth muscle cells. Cell Immunol. 208(1): 1-8.
  • Ostermann H. (2002) Antithrombin III in Sepsis. New evidences and open questions. Minerva Anestesiol. 68(5): 445-8.
  • Caglikulekci M, et al. (2004) Effect of antithrombin-III (AT-III) on intestinal epithelium changes related to obstructive icterus: experimental study in rats. Ann Chir. 129(5): 273-7.
  • Size / Price
    Catalogue : MG52927-NF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.