After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Souris SerpinD1 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse SERPIND1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_008223.3
Taille du ADNc:1437bp
Description du ADNc:Full length Clone DNA of Mus musculus serine (or cysteine) peptidase inhibitor, clade D, member 1 with N terminal His tag.
Synonyme du gène:HCII, Hcf2, AA985900, AI303446, MGC107662
Espèces:Mouse
Vecteur:pCMV3-SP-N-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Fond

SerpinD1, also known as heparin cofactor II (HCâ…¡), is a member of Serpin superfamily of the serine proteinase inhibitors. HCII is a glycoprotein in human plasma that inhibits thrombin and chymotrypsin, and the rate of inhibition of thrombin is rapidly increased by Dermatan sulfate (DS), heparin (H) and glycosaminoglycans(GAG). The stimulatory effect of glycosaminoglycans on the inhibition is mediated, in part, by the N-terminal acidic domain of HCII. Interestingly, a C-terminal His-tagged recombinant HCII exhibits enhanced activity of thrombin inhibition. It has been suggested that HCII plays an unique and important role in vascular homeostasis, and accordingly mutations in this gene or congenital HCII deficiency is potentially associated with thrombosis. HCII specifically inhibits thrombin action at the site of vascular wall injury and HCII-thrombin complexes have been detected in human plasma. HCII protects against thrombin-induced vascular remodeling in both humans and mice and suggest that HCII is a predictive biomarker and therapeutic target for atherosclerosis. SerpinD1 also inhibits chymotrypsin, but in a glycosaminoglycan-independent manner.

Références
  • Rau JC, et al. (2009) Heparin cofactor II in atherosclerotic lesions from the Pathobiological Determinants of Atherosclerosis in Youth (PDAY) study. Exp Mol Pathol. 87(3): 178-83.
  • Aihara K, et al. (2009) Heparin cofactor II as a novel vascular protective factor against atherosclerosis. J Atheroscler Thromb. 16(5): 523-31.
  • Size / Price
    Catalogue : MG50121-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »