Alpha 2 Antiplasmin / SerpinF2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Price:
Size:
Number:

Alpha 2 Antiplasmin / SerpinF2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1476 bp
Description
Full length Clone DNA of Mouse serine (or cysteine) peptidase inhibitor, clade F, member 2 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Alpha 2 Antiplasmin / SerpinF2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag: Alternative Names

AI747498 cDNA ORF Clone, Mouse; Pli cDNA ORF Clone, Mouse; Serpimf2 cDNA ORF Clone, Mouse

Alpha 2 Antiplasmin / SerpinF2 Background Information

SerpinF2, also known as alpha-2 antiplasmin (alpha-2 AP), is a member of the Serpin superfamily. SerpinF2 is the principal physiological inhibitor of serine protease plasmin, and as well as, an efficient inhibitor of trypsin and chymotrypsin. This protease is produced mainly by liver and kidney, and also expressed in muscle, intestine, central nervous system, and placenta also express this protein at a moderate level. It is indicated that Serpin F2 is a key regulator of plasmin-mediated proteolysis in these tissues. Alpha-2 AP is an unusual serpin in that it contains extensive N- and C-terminal sequences flanking the serpin domain. The N-terminal sequence is crosslinked to fibrin by factor XIIIa, whereas the C-terminal region mediates the initial interaction with plasmin. SerpinF2 is one of the inhibitors of fibrinolysis, which acts as the primary inhibitor of plasmin(ogen). It is a specific plasmin inhibitor, and is important in modulating the effectiveness and persistence of fibrin with respect to its susceptibility to digestion and removal by plasmin. Alpha-2 AP plays the dominant role in inhibiting both plasma clot lysis and thrombus lysis, and accordingly, the congenital deficiency of Alpha-2 antiplasmin causes a rare bleeding disorder because of increased fibrinolysis. Thus, it may be a useful target for developing more effective treatment of thrombotic diseases.
Full Name
serpin peptidase inhibitor, clade F, member 2
References
  • Lee KN, et al. (2004) Alpha2-antiplasmin: potential therapeutic roles in fibrin survival and removal. Curr Med Chem Cardiovasc Hematol Agents. 2(4): 303-10.
  • Matsuno H. (2006) Alpha2-antiplasmin on cardiovascular diseases. Curr Pharm Des. 12(7): 841-7.
  • Burnouf T, et al. (2007) Impact of Triton X-100 on alpha 2-antiplasmin (SERPINF2) activity in solvent/detergent-treated plasma. Biologicals. 35(4): 349-53.
  • Carpenter SL, et al. (2008) Alpha2-antiplasmin and its deficiency: fibrinolysis out of balance. Haemophilia. 14(6): 1250-4.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait