Commande rapide

Souris SH3BGRL3 expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Souris SH3BGRL3 Informations sur les produits clonés de cDNA
    Taille du ADNc:282bp
    Description du ADNc:Full length Clone DNA of Mus musculus SH3 domain binding glutamic acid-rich protein-like 3 with C terminal Flag tag.
    Synonyme du gène:AU022188, 1110004L05Rik
    Site de restriction:
    Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Description de la séquence:
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.