SHMT2 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG51630-CY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All SHMT2 Reagents

CRO Services

Product recommended


All SHMT2 Reagents

SHMT2 cDNA ORF Clone, Mouse, C-HA tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1515 bp
Description
Full length Clone DNA of Mouse serine hydroxymethyltransferase 2 (mitochondrial) with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SHMT2 cDNA ORF Clone, Mouse, C-HA tag Alternative Names

2700043D08Rik cDNA ORF Clone, Mouse;AA408223 cDNA ORF Clone, Mouse;AA986903 cDNA ORF Clone, Mouse

SHMT2 Background Information

Full Name
serine hydroxymethyltransferase 2 (mitochondrial)

SHMT2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SHMT2 cDNA ORF Clone in Cloning Vector, Mouse MG51630-G
SHMT2 cDNA ORF Clone, Mouse, untagged MG51630-UT
SHMT2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51630-ACGLN
SHMT2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51630-ACG
SHMT2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51630-ANG
SHMT2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51630-ACR
SHMT2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51630-ANR
SHMT2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51630-CF
SHMT2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51630-NF
SHMT2 cDNA ORF Clone, Mouse, C-His tag MG51630-CH
SHMT2 cDNA ORF Clone, Mouse, N-His tag MG51630-NH
SHMT2 cDNA ORF Clone, Mouse, N-HA tag MG51630-NY
SHMT2 cDNA ORF Clone, Mouse, C-Myc tag MG51630-CM
SHMT2 cDNA ORF Clone, Mouse, N-Myc tag MG51630-NM
SHMT2 qPCR Primer Pairs, Mouse MP201503

SHMT2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SHMT2 cDNA ORF Clone in Cloning Vector, Human HG13426-G
SHMT2 cDNA ORF Clone, Human, untagged HG13426-UT
SHMT2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13426-ACGLN
SHMT2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13426-ACG
SHMT2 cDNA ORF Clone, Human, N-GFPSpark® tag HG13426-ANG
SHMT2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13426-ACR
SHMT2 cDNA ORF Clone, Human, N-OFPSpark® tag HG13426-ANR
SHMT2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13426-CF
SHMT2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13426-NF
SHMT2 cDNA ORF Clone, Human, C-His tag HG13426-CH
SHMT2 cDNA ORF Clone, Human, N-His tag HG13426-NH
SHMT2 cDNA ORF Clone, Human, C-HA tag HG13426-CY
SHMT2 cDNA ORF Clone, Human, N-HA tag HG13426-NY
SHMT2 cDNA ORF Clone, Human, C-Myc tag HG13426-CM
SHMT2 cDNA ORF Clone, Human, N-Myc tag HG13426-NM
SHMT2 qPCR Primer Pairs, Human HP102128
info info
添加购物车成功! 添加购物车失败!