After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Souris SIGIRR/TIR8 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse SIGIRR Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_023059.3
Taille du ADNc:1230bp
Description du ADNc:Full length Clone DNA of Mus musculus single immunoglobulin and toll-interleukin 1 receptor (TIR) domain with N terminal His tag.
Synonyme du gène:TIR8, AI256711, MGC102426
Espèces:Mouse
Vecteur:pCMV3-SP-N-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Fond

Single Ig IL-1-related receptor (SIGIRR) or TIR8 is a member of Toll-like receptor-interleukin 1 receptor signaling (TLR-IL-1R) receptor superfamily. Although SIGIRR/TIR8 shows the typical conserved motifs that characterize the IL-1R and Toll superfamily, it is structurally and functionally distinct from both. SIGIRR/TIR8 has only one Ig domain in its extracellular portion whereas the IL-1R family contains three Ig folds. An unusually long cytoplasmic domain is reminiscent of the structure of drosophila Toll, yet the SIGIRR peptide sequence is more closely related to IL-1RI. SIGIRR/TIR8 was mainly expressed in mouse and human epithelial tissues such as kidney, lung and gut. Resting and activated T and B lymphocytes and monocytes-macrophages expressed little or no SIGIRR/TIR8, with the exception of the mouse GG2EE macrophage line. Inflammation is enhanced in SIGIRR-deficient mice. SIGIRR negatively modulates immune responses. Inflammation is enhanced in SIGIRR-deficient mice, as shown by their enhanced chemokine induction after IL-1 injection and reduced threshold for lethal endotoxin challenge.

Références
  • Wald D, et al. (2003) SIGIRR, a negative regulator of Toll-like receptor-interleukin 1 receptor signaling. Nat Immunol. 4(9): 920-7.
  • Polentarutti N, et al. (2003) Unique pattern of expression and inhibition of IL-1 signaling by the IL-1 receptor family member TIR8/SIGIRR. Eur Cytokine Netw. 14(4): 211-8.
  • Wald D, et al. (2003) SIGIRR, a negative regulator of Toll-like receptor-interleukin 1 receptor signaling. Nat Immunol. 4(9): 920-7.
  • Size / Price
    Catalogue : MG50122-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »