After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Souris Ly108/SLAMF6 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse SLAMF6 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_030710.2
Taille du ADNc:996bp
Description du ADNc:Full length Clone DNA of Mus musculus SLAM family member 6.
Synonyme du gène:KAL1, NTBA, KAL1b, Ly108, NTB-A, SF2000, Slamf6
Espèces:Mouse
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Fond

SLAM family member 6, also known as Activating NK receptor, NK-T-B-antigen, NTB-A, SLAMF6, KALI and Ly108, is a single-pass type I membrane protein which belongs to the CD2 subfamily of the immunoglobulin superfamily. SLAMF6 / Ly108 contains one Ig-like (immunoglobulin-like) domain. It is expressed by all (resting and activated) natural killer cells (NK), T- and B-lymphocytes. SLAMF6 / Ly108 triggers cytolytic activity only in natural killer cells (NK) expressing high surface densities of natural cytotoxicity receptors. SLAMF6 / Ly108 is a homodimer. It interacts with PTN6 and, upon phosphorylation, with PTN11 and SH2D1A/SAP. SLAMF6 / Ly108 undergoes tyrosine phosphorylation and associates with the Src homology 2 domain-containing protein (SH2D1A) as well as with SH2 domain-containing phosphatases (SHPs). It may function as a coreceptor in the process of NK cell activation. SLAMF6 / Ly108 can also mediate inhibitory signals in NK cells from X-linked lymphoproliferative patients.

Références
  • Gray CW. et al., 2000, Eur J Biochem. 267 (18): 5699-710.
  • Bottino C. et al., 2001, J Exp Med. 194 (3): 235-46.
  • Valdez PA. et al., 2004, J Biol Chem. 279 (18): 18662-9.
  • Claus M. et al., 2007, Front Biosci. 13: 956-65.
  • Size / Price
    Catalogue : MG50275-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »