SLC25A35 cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

SLC25A35 cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
903 bp
Description
Full length Clone DNA of Mouse solute carrier family 25, member 35.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SLC25A35 cDNA ORF Clone, Mouse, untagged: Alternative Names

1810012H11Rik cDNA ORF Clone, Mouse

SLC25A35 Background Information

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait