After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Souris SLIT2 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse SLIT2 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_178804.3
Taille du ADNc:4566bp
Description du ADNc:Full length Clone DNA of Mus musculus slit homolog 2 (Drosophila) with C terminal His tag.
Synonyme du gène:Slil3, Drad-1, KIAA4141, mKIAA4141, E030015M03Rik, E130320P19Rik, Slit2
Espèces:Mouse
Vecteur:pCMV3-C-His
Plasmid:pCMV3-mSLIT2-His
Site de restriction:KpnI + XbaI (6kb + 4.62kb)
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 819 C/T, 1512 T/C, 1716 C/T, 2217 T/C and 3610 A/C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse SLIT2 Gene Plasmid Map
Mouse SLIT2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Size / Price
Catalogue : MG50443-CH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
DisponibilitéIn Stock
Bulk Discount RequiryAjouter au panier
Contact Us
Images
  • Mouse SLIT2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »