After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Souris SLITRK1 expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse SLITRK1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_199065.2
Taille du ADNc:2091bp
Description du ADNc:Full length Clone DNA of Mus musculus SLIT and NTRK-like family, member 1 with C terminal Myc tag.
Synonyme du gène:3200001I04Rik, Slitrk1
Espèces:Mouse
Vecteur:pCMV3-C-Myc
Plasmid:
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Fond

SLITRK1 (Slit and Trk-like family member 1) is a integral membrane protein belonging to the SLITRK family consists of at least 6 members (SLITRK1-6). They are named and characterized by the presence of two leucine-rich repeats (LRRs) in the extracellular domain similar to those found in a secreted axonal growth-controlling protein, Slit, as well as a C-terminal domain with homology to Trk neurotrophin tyrosine kinase receptors. Expression of SLITRKs are highly restricted to neural tissues, and are identified as the neuronal components modulating the neurite outgrowth. More specifically, SLITRK1 expression is found in the mature neurons of the cerebrum, thalamus and hippocampus, and induces unipolar neurites in cultured neuronal cells. Human SLITRK1 is a 696 amino acid precursor protein, and one truncating frameshift mutation (448 aa) has been linked to Tourette's syndrome, a genetically influenced developmental neuropsychiatric disorder characterized by chronic vocal and motor tics. In addition, all SLITRK genes are differentially expressed in brain tumors, such as astrocytoma, oligodendroglioma, glioblastoma, and are suggested to be useful molecular indicators of brain tumor properties.

Références

1. Aruga, J. and Mikoshiba, K. 2003, Mol. Cell. Neurosci. 24: 117-129.

2. Aruga, J. et al., 2003, Gene. 315: 87-94.

3. Abelson, J.F. et al., 2005, Science. 310: 317-320.

4. Grados, M.A. and Walkup. J.T. 2006, Trends. Genet. 22: 291-293.

Size / Price
Catalogue : MG50382-CM
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »