Commande rapide

Souris SMPD1 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Souris SMPD1 Informations sur les produits clonés de cDNA
Taille du ADNc:1884bp
Description du ADNc:Full length Clone DNA of Mus musculus sphingomyelin phosphodiesterase 1, acid lysosomal with N terminal His tag.
Synonyme du gène:ASM, aSMase, A-SMase, Zn-SMase, Smpd1
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
( We provide with SMPD1 qPCR primers for gene expression analysis, MP200724 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name

Sphingomyelin phosphodiesterase 1 (SMPD1) , also known as ASM ( acid sphingomyelinase ), is a member of the acid sphingomyelinase family of enzymes. Three isoforms have been identified, isoform 1 is 631 amino acids (aa) in length as the pro form, while Isoform 2 and isoform 3 have lost catalytic activity. The active SMPD1 isoform 1 contains one saposin B-type domain that likely interacts with sphingomyelin, and a catalytic region. Human SMPD1 is 86% aa identical to mouse SMPD1. SMPD1 is a monomeric lysosomal enzyme that converts sphingomyelin (a plasma membrane lipid ) into ceramide through the removal of phosphorylcholine. This generates second messenger components that participate in signal transduction. Defects in SMPD1 are the cause of Niemann-Pick disease type A (NPA) and type B (NPB), also known as Niemann-Pick disease classical infantile form and Niemann-Pick disease visceral form. Niemann-Pick disease is a clinically and genetically heterogeneous recessive disorder. NPB has little if any neurologic involvement and patients may survive into adulthood.

Size / Price
Catalogue : MG50749-NH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Ajouter au panierBulk Discount Requiry
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.