SOSTDC1 cDNA ORF Clone, Mouse, C-Myc tag

Price:
Size:
Number:

SOSTDC1 cDNA ORF Clone, Mouse, C-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
621 bp
Description
Full length Clone DNA of Mouse sclerostin domain containing 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SOSTDC1 cDNA ORF Clone, Mouse, C-Myc tag: Alternative Names

0610006G05Rik cDNA ORF Clone, Mouse; ectodin cDNA ORF Clone, Mouse; Sostl cDNA ORF Clone, Mouse; USAG-1 cDNA ORF Clone, Mouse; Wise cDNA ORF Clone, Mouse

SOSTDC1 Background Information

The sclerostin domain containing protein 1 (SOSTDC1) is a cell signaling regulator involved in cell physiology and pathology. SOSTDC1 exerted its tumor suppressor function by inhibiting the activity of major signaling pathways including the phosphatidylinositol-3-kinase (PI3K)/Akt and mitogen-activated protein kinase (MAPK)/Erk pathways. SOSTDC1 might represent a tumor suppressor through inhibiting the proliferation of NSCLC cells by regulating p21Cip and p27Kip, which in turn affects Rb-E2F signaling. SOSTDC1 is down-regulated in thyroid cancer and might be a potential therapeutic target in the treatment of thyroid cancer.
Full Name
sclerostin domain containing 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait