Commande rapide

Text Size:AAA

Souris Osteonectin / SPARC expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse SPARC Informations sur les produits clonés de cDNA
Taille du ADNc:909bp
Description du ADNc:Full length Clone DNA of Mus musculus secreted acidic cysteine rich glycoprotein with C terminal HA tag.
Synonyme du gène:BM-40, AA517111
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name

Secreted protein acidic and rich in cysteine (SPARC), also known as Osteonectin (ON), is a member of the SPARC family. SPARC consists of three domains: a EF-hand domain, a follistatin-like domain and a Kazal-like domain, and each of which has independent activity and unique properties. The activity of SPARC is context- and cell-type-dependent, which is highlighted by the fact that SPARC has shown seemingly contradictory effects on tumor progression in both clinical correlative studies and in animal models. The location of SPARC in the nuclear matrix of certain proliferating cells, but only in the cytosol of postmitotic neurons, indicates potential functions of SPARC as a nuclear protein, which might be involved in the regulation of cell cycle progression and mitosis. It functions not only to modulate cell-cell and cell-matrix interactions, but its de-adhesive and growth inhibitory properties in non-transformed cells have led to studies to assess its role in cancer. Its divergent actions reflect the complexity of this protein, because in certain types of cancers, such as melanomas and gliomas, SPARC is associated with a highly aggressive tumor phenotype, while in others, mainly ovarian, neuroblastomas and colorectal cancers, SPARC may function as a tumor suppressor. Recent studies have also demonstrated a role for SPARC in sensitizing therapy-resistant cancers. Notably, SPARC is linked to human obesity.

  • Yan Q, et al. (1999) SPARC, a matricellular glycoprotein with important biological functions. J Histochem Cytochem. 47(12): 1495-506.
  • Brekken RA, et al. (2000) SPARC, a matricellular protein: at the crossroads of cell-matrix. Matrix Biol. 19(7): 569-80.
  • Tai IT, et al. (2008) SPARC in cancer biology: its role in cancer progression and potential for therapy. Drug Resist Updat. 11(6): 231-46.
  • Podhajcer OL, et al. (2008) The role of the matricellular protein SPARC in the dynamic interaction between the tumor and the host. Cancer Metastasis Rev. 27(3): 523-37.
  • Kos K, et al. (2010) SPARC: a key player in the pathologies associated with obesity and diabetes. Nat Rev Endocrinol. 6(4): 225-35.
  • Size / Price
    Catalogue : MG50494-CY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.