Commande rapide

Text Size:AAA

Souris SRC/Proto-oncogene c-Src transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse SRC Informations sur les produits clonés de cDNA
Taille du ADNc:1626bp
Description du ADNc:Full length Clone DNA of Mus musculus Rous sarcoma oncogene transcript variant 1 with C terminal HA tag.
Synonyme du gène:AW259666, pp60c-src, Src
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Souris SRC/Proto-oncogene c-Src transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur on other vectors
Souris SRC/Proto-oncogene c-Src transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurMG51118-ACGCHF290
Souris SRC/Proto-oncogene c-Src transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurMG51118-ACRCHF290
Souris SRC/Proto-oncogene c-Src transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurMG51118-ANGCHF290
Souris SRC/Proto-oncogene c-Src transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurMG51118-ANRCHF290
Souris SRC/Proto-oncogene c-Src transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurMG51118-CFCHF260
Souris SRC/Proto-oncogene c-Src transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurMG51118-CHCHF260
Souris SRC/Proto-oncogene c-Src transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurMG51118-CMCHF260
Souris SRC/Proto-oncogene c-Src transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurMG51118-CYCHF260
Souris SRC/Proto-oncogene c-Src transcript variant 1 Gène ADNc clone le vecteur de clonageMG51118-GCHF90
Souris SRC/Proto-oncogene c-Src transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurMG51118-G-FCHF260
Souris SRC/Proto-oncogene c-Src transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurMG51118-NFCHF260
Souris SRC/Proto-oncogene c-Src transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurMG51118-NHCHF260
Souris SRC/Proto-oncogene c-Src transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurMG51118-NMCHF260
Souris SRC/Proto-oncogene c-Src transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurMG51118-NYCHF260
Souris SRC/Proto-oncogene c-Src transcript variant 1 expression plasmide de Gène l'ADNc ORF cloneMG51118-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Proto-oncogene tyrosine-protein kinase SRC is a hydrophobic protein belonging to the SRC family kinase including nine members that is a family of non-receptor tyrosine kinases. SRC protein may exist in different forms: C-SRC and V-SRC. C-SRC is only activated under certain circumstances where it is required such as growth factor signaling, while V-SRC is a constitutively active as opposed to normal SRC (C-SRC). Thus, V-SRC is an instructive example of an oncogene protein kinase whereas C-SRC is a proto-oncogene protein kinase. Inhibition of SRC with NR2A tyrosine phosphorylation mediated by PSD-95 may contribute to the lithium-induced downregulation of NMDA receptor function and provide neuroprotection against excitotoxicity.

  • Juan Ma. et al., 2003, Neuroscience Letters. 348 (3): 185-189.
  • Czernilofsky AP. et al., 1980, Nature. 287: 198-203.
  • Beischlag TV. et al., 2002, Molecular and cellular biology. 22 (12): 4319-33.
  • Size / Price
    Catalogue : MG51118-CY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.