After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Souris SRFBP1 (p49/STRAP) expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse SRFBP1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_026040.3
Taille du ADNc:1326bp
Description du ADNc:Full length Clone DNA of Mus musculus serum response factor binding protein 1 with C terminal Flag tag.
Synonyme du gène:p49/STRAP, 2810036K01Rik
Espèces:Mouse
Vecteur:pCMV3-C-FLAG
Plasmid:
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Souris SRFBP1 (p49/STRAP) expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur on other vectors
Product nameProduct name
Fond

SRFBP1 contains 7 WD repeats and belongs to the WD repeat STRAP family. SRFBP1 may play a role in the cellular distribution of the SMN complex. The SMN complex plays an essential role in spliceosomal snRNP assembly in the cytoplasm and is required for pre-mRNA splicing in the nucleus. SRFBP1 negatively regulates TGF-beta signaling but positively regulates the PDPK1 kinase activity by enhancing its autophosphorylation and by significantly reducing the association of PDPK1 with 14-3-3 protein. SRFBP1 may be involved in regulating transcriptional activation of cardiac genes during the aging process. It also may play a role in biosynthesis and/or processing of SLC2A4 in adipose cells.

Références
  • Datta PK, et al. (1999) Identification of STRAP, a novel WD domain protein in transforming growth factor-beta signaling. J Biol Chem. 273(52):34671-4.
  • Datta PK, et al. (1998) Identification of STRAP, a novel WD domain protein in transforming growth factor-beta signaling. J Biol Chem. 273(52):34671-4.
  • Datta PK, et al. (2000) STRAP and Smad7 synergize in the inhibition of transforming growth factor beta signaling. Mol Cell Biol. 20(9):3157-67.
  • Size / Price
    Catalogue : MG51646-CF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »