STAT5b cDNA ORF Clone, Mouse, N-Myc tag

Price:
Size:
Number:

STAT5b cDNA ORF Clone, Mouse, N-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2361 bp
Description
Full length Clone DNA of Mouse signal transducer and activator of transcription 5B with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

STAT5b Background Information

The transcription factor STAT5b is an antitumor target. STAT5b confers gemcitabine chemoresistance and promotes cell adherence and invasiveness in pancreatic cancer cells. Targeting STAT5b may lead to novel therapeutic strategies for PDAC. Signal transducer and activator of transcription 5b (STAT5b) is a growth hormone (GH)-activated transcription factor and a master regulator of sexually dimorphic gene expression in the liver. Disruption of the GH hypothalamo-pituitary-liver axis controlling STAT5b activation can lead to metabolic dysregulation, steatosis, and liver cancer.
Full Name
signal transducer and activator of transcription 5B
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait