Smad2 cDNA ORF Clone, Mouse, untagged

1/1
Price:
Size:
Number:

Smad2 cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1404 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 219A/G,573G/T,888G/A均 not causing the amino acid variation.
Description
Full length Clone DNA of Mouse Mothers against decapentaplegic homolog 2.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI(6.1kb+1.4kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Smad2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Smad2 cDNA ORF Clone, Mouse, untagged: Validated Images

Smad2 cDNA ORF Clone, Mouse, untagged: Alternative Names

7120426M23Rik cDNA ORF Clone, Mouse; Madh2 cDNA ORF Clone, Mouse; Madr2 cDNA ORF Clone, Mouse; mMad2 cDNA ORF Clone, Mouse; Smad-2 cDNA ORF Clone, Mouse

Smad2 Background Information

SMAD2 is a member of the SMAD family. Members of this family mediate signal transduction by the TGF-beta/activin/BMP-2/4 cytokine superfamily from receptor Ser/Thr protein kinases at the cell surface to the nucleus. SMAD2 mediates the signal of the TGF-beta, and therefore regulates multiple cellular processes, such as cell proliferation, apoptosis, and differentiation. SMAD2 is recruited to the TGF-beta receptors through its interaction with the SMAD anchor for receptor activation (SARA) protein. SMAD2 is the downstream signal transducers of TGF-beta-1 in human dental pulp cells. In response to TGF-beta signal, this protein is phosphorylated by the TGF-beta receptors. Phosphorylated SMAD2 is able to form a complex with SMAD4 or SARA. These complexes accumulate in the cell nucleus, where they are directly participating in the regulation of gene expression.
Full Name
SMAD family member 2
References
  • Feng. et al., 2002, Mol Cell. 9 (1): 133-43.
  • Zhu Y. et al., 1997, J Biol Chem. 272 (15): 10035-40.
  • Zi Z. et al., 2012, FEBS Lett. 586 (14): 1921-8.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait