After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Souris Smad5 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse SMAD5 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_008541.3
Taille du ADNc:1398bp
Description du ADNc:Full length Clone DNA of Mus musculus Mothers against decapentaplegic homolog 5 with N terminal His tag.
Synonyme du gène:Madh5, Msmad5
Espèces:Mouse
Vecteur:pCMV3-N-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Fond

SMAD5 is a member of the SMAD family. Members of this family mediate signal transduction by the TGF-beta/activin/BMP-2/4 cytokine superfamily from receptor Ser/Thr protein kinases at the cell surface to the nucleus. SMAD5 is involved in the TGF-beta signaling pathway that results in an inhibition of the proliferation of hematopoietic progenitor cells. It is also involved in cell signalling and modulates signals of bone morphogenetic proteins (BMP's). The binding of ligands causes the oligomerization and phosphorylation of the SMAD5 protein. SMAD5 is a receptor regulated SMAD (R-SMAD) and is activated by bone morphogenetic protein type 1 receptor kinase.

Références
  • Vinayagam A. et al., 2011, Sci Signal. 4 (189): rs8.
  • Sangadala S. et al., 2007, J Biomol Struct Dyn. 25 (1): 11-23.
  • Riggins GJ. et al., 1996, Nat Genet. 13 (3): 347-9.
  • Size / Price
    Catalogue : MG50728-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »