DP1 cDNA ORF Clone, Mouse, N-HA tag

Price:
Size:
Number:

DP1 cDNA ORF Clone, Mouse, N-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1233 bp
Description
Full length Clone DNA of Mouse transcription factor Dp 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

DP1 cDNA ORF Clone, Mouse, N-HA tag: Alternative Names

Dp1 cDNA ORF Clone, Mouse; Drtf1 cDNA ORF Clone, Mouse

DP1 Background Information

TFDP1 is an important transcription factor that coordinates with E2F proteins, thereby promoting transcription of E2F target genes and regulating the cell cycle and differentiation. The gene TFDP1 and the cell cycle pathway are strongly associated with high-grade GBM. DP-1 is a heterodimerization partner for members of the E2F family of transcription factors; E2F/DP-1 regulates the expression of various cellular promoters, particularly gene products that are involved in the cell cycle. and the DP-1 gene ( TFDP1) as a probable target within a 13q34 amplicon that is frequently detected in hepatocellular carcinomas (HCC) and esophageal squamous-cell carcinomas.The overexpression of TFDP1 may contribute to progression of some HCCs by promoting growth of the tumor cells.
Full Name
transcription factor Dp-1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait