Commande rapide

Text Size:AAA

Souris TGFBR3 / Betaglycan expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse TGFBR3 Informations sur les produits clonés de cDNA
Taille du ADNc:2553bp
Description du ADNc:Full length Clone DNA of Mus musculus transforming growth factor, beta receptor III with N terminal HA tag.
Synonyme du gène:TBRIII, AU015626, AW215636, 1110036H20Rik, Tgfbr3
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name

Betaglycan also known as transforming growth factor beta receptor III (TGFBR3), is a cell-surface chondroitin sulfate / heparan sulfate proteoglycan. TGFBR3 is a transforming growth factor (TGF)-beta type III receptor. This receptor is a membrane proteoglycan that often functions as a co-receptor with other TGF-beta receptor superfamily members. Ectodomain shedding produces soluble TGFBR3, which may inhibit TGFB signaling. Decreased expression of this receptor has been observed in various cancers. TGFBR3 is the TGF-β component most commonly downregulated among localized human prostate cancer studies. TGFBR3 knockdown led to focus formation and enhanced expression of CD133, a marker found on prostate cancer stem cells. TGFBR3 is an accessory receptor that binds to and modulates the activities of both transforming growth factor-beta (TGFβ) and inhibin, two members of the TGFβ superfamily of growth factors that regulate many aspects of reproductive biology. TGFBR3 is known to be expressed in adult testis and ovary, but little is known about this receptor during gonadogenesis.

  • Johnson DW, et al. (1996) Assignment of human transforming growth factor-beta type I and type III receptor genes (TGFBR1 and TGFBR3) to 9q33-q34 and 1p32-p33, respectively. Genomics. 28 (2): 356-7.
  • Rotzer D, et al. (2001) Type III TGF-beta receptor-independent signalling of TGF-beta2 via T betaRII-B, an alternatively spliced TGF- type II receptor. EMBO J. 20 (3): 480-90.
  • Gao J, et al. (1999) Expression of transforming growth factor-beta receptors types II and III within various cells in the rat periodontium. J Periodont Res. 34 (2): 113-22.
  • Size / Price
    Catalogue : MG50542-NY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.