TIGIT cDNA ORF Clone, Mouse, N-Myc tag

1/1
Price:
Size:
Number:

TIGIT cDNA ORF Clone, Mouse, N-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
735 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse T cell immunoreceptor with Ig and ITIM domains with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI(6kb+0.74kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

TIGIT cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TIGIT cDNA ORF Clone, Mouse, N-Myc tag: Validated Images

TIGIT cDNA ORF Clone, Mouse, N-Myc tag: Alternative Names

ENSMUSG00000071552 cDNA ORF Clone, Mouse; Vstm3 cDNA ORF Clone, Mouse

TIGIT Background Information

TIGIT, also known as V-set and transmembrane domain-containing protein 3 (VSTM3) or V-set and immunoglobulin domain-containing protein 9 (VSIG9) is a new surface protein containing an immunoglobulin variable domain, a transmembrane domain and an immunoreceptor tyrosine-based inhibitory motif (ITIM). TIGIT is expressed on regulatory, memory, activated T cells and NK cells. It binds PVR with high affinity, and PVRL2 with lower affinity, but not PVRL3. Knockdown of TIGIT with siRNA in human memory T cells did not affect T cell responses, however, TIGIT inhibits NK cytotoxicity directly through its ITIM. TIGIT suppresses T cell activation by promoting the generation of mature immunoregulatory dendritic cells. The binding of PVR to TIGIT on human dendritic cells enhanced the production of IL-1 and diminished the production of IL-12p4. In addition, TIGIT counter inhibits the NK-mediated killing of tumor cells and protects normal cells from NK-mediated cytotoxicity thus providing an "alternative self" mechanism for MHC class I inhibition.
Full Name
T cell immunoreceptor with Ig and ITIM domains
References
  • Ota T., et al.,(2004), Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat. Genet. 36:40-45.
  • Bechtel S., et al., (2007), The full-ORF clone resource of the German cDNA consortium.BMC Genomics 8:399-399.
  • Yu X., Harden K., et al.,(2009), The surface protein TIGIT suppresses T cell activation by promoting the generation of mature immunoregulatory dendritic cells. Nat. Immunol. 10:48-57.

TIGIT cDNA ORF Clone, Cynomolgus, Related Products

TIGIT cDNA ORF Clone, Rabbit, Related Products

TIGIT cDNA ORF Clone, Canine, Related Products

Add to Cart Successfully Add to Cart Failed