TMEM230 cDNA ORF Clone, Mouse, N-GFPSpark® tag

Price:
Size:
Number:

TMEM230 cDNA ORF Clone, Mouse, N-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
363 bp
Description
Full length Clone DNA of Mouse transmembrane protein 230 with N terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

TMEM230 cDNA ORF Clone, Mouse, N-GFPSpark® tag: Alternative Names

5730494N06Rik cDNA ORF Clone, Mouse; AA407821 cDNA ORF Clone, Mouse

TMEM230 Background Information

Full Name
transmembrane protein 230
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait