Commande rapide

Souris TNFR1/TNFRSF1A/CD120a expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse TNFRSF1A Informations sur les produits clonés de cDNA
Taille du ADNc:1365bp
Description du ADNc:Full length Clone DNA of Mus musculus tumor necrosis factor receptor superfamily, member 1a with C terminal HA tag.
Synonyme du gène:FPF, p55, TNF-R, TNFAR, TNFRI, Tnfr1, p55-R, CD120a, TNF-R1, TNFR60, Tnfr-2, TNF-R-I, TNF-R55, TNFRp55, TNF-alphaR1
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD120a (cluste of differentiation 120a), also known as TNFR1 / TNFRSF1A, is a member of CD family, tumor necrosis factor receptor superfamily. CD120a is one of the most primary receptors for the tumor necrosis factor-alpha. It has been shown to be localized to both plasma membrane lipid rafts and the trans golgi complex with the help of the death domain (DD). CD120a can activate the transcription factor NF-κB, mediate apoptosis, and regulate inflammation processes.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Cottin V, et al. (2002) Restricted localization of the TNF receptor CD120a to lipid rafts: a novel role for the death domain. The journal of immunology. 168: 4095-102.
  • Size / Price
    Catalogue : MG50496-CY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.