TRAIL cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

1/1
Price:
Size:
Number:

TRAIL cDNA ORF Clone, Mouse, N-DDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
876 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse tumor necrosis factor (ligand) superfamily, member 10 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 0.92kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

TRAIL cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TRAIL cDNA ORF Clone, Mouse, N-DDK (Flag®) tag: Validated Images

TRAIL cDNA ORF Clone, Mouse, N-DDK (Flag®) tag: Alternative Names

A330042I21Rik cDNA ORF Clone, Mouse; AI448571 cDNA ORF Clone, Mouse; APO-2L cDNA ORF Clone, Mouse; Ly81 cDNA ORF Clone, Mouse; TL2 cDNA ORF Clone, Mouse; Trail cDNA ORF Clone, Mouse

TRAIL Background Information

Tumor necrosis factor ligand superfamily member 1 (TNFSF1), also known as TNF-related apoptosis-inducing ligand (TRAIL), Apo-2 ligand, and CD253, is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. TNFSF1 / Apo-2L / CD253 functions as a ligand that induces the process of cell death called apoptosis. TNFSF1 / TRAIL shows homology to other members of the tumor necrosis factor superfamily. As one member of the cluster of differentiation system, TNFSF1 / CD253 is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 32 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion TNFSF1 / Apo-2L / CD253 / TRAIL binds to several members of TNF receptor superfamily including TNFRSF1A / TRAILR1, TNFRSF1B / TRAILR2, TNFRSF1C / TRAILR3, TNFRSF1D / TRAILR4, and possibly also to TNFRSF11B/OPG. The activity of TNFSF1 / TRAIL may be modulated by binding to the decoy receptors TNFRSF1C / TRAILR3, TNFRSF1D/TRAILR4, and TNFRSF11B/OPG that cannot induce apoptosis. The binding of this protein to its receptors has been shown to trigger the activation of MAPK8 / JNK, caspase 8, and caspase 3. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.
Full Name
tumor necrosis factor (ligand) superfamily, member 10
References
  • Song C, et al. (2005) TRAIL (CD253), a new member of the TNF superfamily. J Biol Regul Homeost Agents. 19(1-2): 73-7.
  • Kuribayashi K, et al. (2008) TNFSF10 (TRAIL), a p53 target gene that mediates p53-dependent cell death. Cancer Biol Ther. 7(12): 2034-8.
  • Wiley SR, et al. (1995) Identification and characterization of a new member of the TNF family that induces apoptosis. Immunity. 3(6): 673-82.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait