TPM1 cDNA ORF Clone, Mouse, C-HA tag

Price:
Size:
Number:

TPM1 cDNA ORF Clone, Mouse, C-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
846 bp
Description
Full length Clone DNA of Mouse ancient ubiquitous protein 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

TPM1 cDNA ORF Clone, Mouse, C-HA tag: Alternative Names

AA986836 cDNA ORF Clone, Mouse; AI854628 cDNA ORF Clone, Mouse; alpha-TM cDNA ORF Clone, Mouse; TM2 cDNA ORF Clone, Mouse; Tm3 cDNA ORF Clone, Mouse; Tmpa cDNA ORF Clone, Mouse; Tpm-1 cDNA ORF Clone, Mouse

TPM1 Background Information

TPM1, also known as tropomyosin-1, is a member of the tropomyosin family. Members of this family are highly conserved, widely distributed actin-binding proteins involved in the contractile system of striated and smooth muscles and the cytoskeleton of non-muscle cells. highly conserved, widely distributed actin-binding proteins involved in the contractile system of striated and smooth muscles and the cytoskeleton of non-muscle cells. TPM1 is one type of alpha helical chain that forms the predominant tropomyosin of striated muscle. It binds to actin filaments in muscle and non-muscle cells. TPM1 plays a central role, in association with the troponin complex, in the calcium dependent regulation of vertebrate striated muscle contraction.
Full Name
tropomyosin 1 (alpha)
References
  • Mogensen J. et al., 1999, Cytogenet Cell Genet. 84 (1-2): 35-6.
  • Brown H R. et al., 1985, Proc Natl Acad Sci. 82 (8): 2359-63.
  • Lees-Miller JP. et al., 1992, BioEssays. 13 (9): 429-37.

TPM1 cDNA ORF Clone, Mouse, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait