After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Souris CLN2 expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse TPP1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_009906.5
Taille du ADNc:1689bp
Description du ADNc:Full length Clone DNA of Mus musculus tripeptidyl peptidase I with N terminal Myc tag.
Synonyme du gène:Cln2; TPP-I
Espèces:Mouse
Vecteur:pCMV3-N-Myc
Plasmid:
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Fond

Tripeptidyl-peptidase 1 (TPP1 / CLN2) is a member of the sedolisin family of serine proteases. The protease functions in the lysosome to cleave N-terminal tripeptides from substrates, and has weaker endopeptidase activity. It is synthesized as a catalytically-inactive enzyme which is activated and auto-proteolyzed upon acidification. TPP1 / CLN2 May act as a non-specific lysosomal peptidase which generates tripeptides from the breakdown products produced by lysosomal proteinases. Defects in TPP1 / CLN2 are the cause of neuronal ceroid lipofuscinosis type 2 (CLN2), a form of neuronal ceroid lipofuscinosis which is associated with the failure to degrade specific neuropeptides and a subunit of ATP synthase in the lysosome. Neuronal ceroid lipofuscinoses are progressive neurodegenerative, lysosomal storage diseases characterized by intracellular accumulation of autofluorescent liposomal material, and clinically by seizures, dementia, visual loss, and/or cerebral atrophy.

Références
  • Xin H, et al. (2007) TPP1 is a homologue of ciliate TEBP-beta and interacts with POT1 to recruit telomerase. Nature. 445(7127): 559-62.
  • O'Connor MS, et al. (2006) A critical role for TPP1 and TIN2 interaction in high-order telomeric complex assembly. Proc Natl Acad Sci U S A. 103(32): 11874-9.
  • Abreu E, et al. (2010) TIN2-tethered TPP1 recruits human telomerase to telomeres in vivo. Mol Cell Biol. 30(12): 2971-82.
  • Size / Price
    Catalogue : MG52010-NM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »