Commande rapide

Souris TCTP /TPT1 expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse TPT1 Informations sur les produits clonés de cDNA
Taille du ADNc:519 bp
Description du ADNc:Full length Clone DNA of Mus musculus tumor protein, translationally-controlled 1
Synonyme du gène:p21,p23,TCTP,Trt
Vecteur:pUC19 Vector
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at ambient temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Souris TCTP /TPT1 expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur on other vectors
Product nameProduct name

Tumor protein, also known as TPT1, is a highly conserved protein among many eukaryotic organisms. Tumor protein is involved in a variety of cellular activities, including microtubule stabilization, calcium-binding activities, and apoptosis. The Mammalian translationally controlled tumour protein (TPT1) (or P23) is a protein which has been found to be preferentially synthesised in cells during the early growth phase of some types of tumour, but which is also expressed in normal cells. It was first identified as a histamine-releasing factor, acting in IgE +-dependent allergic reactions. In addition, TPT1 has been shown to bind to tubulin in the cytoskeleton, has a high affinity for calcium, is the binding target for the antimalarial compound artemisinin, and is induced in vitamin D-dependent apoptosis. TPT1 production is thought to be controlled at the translational as well as the transcriptional level.

  • Thaw P. et al., 2001, Nat Struct Biol. 8 (8): 701-4.
  • Thiele H. et al., 2000, Eur J Biochem. 267 (17): 5473-81.
  • Chitpatima ST. et al., 1988, Nucleic Acids Res. 16 (5): 2350.
  • Size / Price
    Catalogue : MG51648-CF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.