After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Souris TCTP /TPT1 expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse TPT1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_008125.3
Taille du ADNc:519 bp
Description du ADNc:Full length Clone DNA of Mus musculus tumor protein, translationally-controlled 1
Synonyme du gène:p21,p23,TCTP,Trt
Espèces:Mouse
Vecteur:pCMV3-C-Myc
Plasmid:
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at ambient temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Souris TCTP /TPT1 expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur on other vectors
Product nameProduct name
Fond

Tumor protein, also known as TPT1, is a highly conserved protein among many eukaryotic organisms. Tumor protein is involved in a variety of cellular activities, including microtubule stabilization, calcium-binding activities, and apoptosis. The Mammalian translationally controlled tumour protein (TPT1) (or P23) is a protein which has been found to be preferentially synthesised in cells during the early growth phase of some types of tumour, but which is also expressed in normal cells. It was first identified as a histamine-releasing factor, acting in IgE +-dependent allergic reactions. In addition, TPT1 has been shown to bind to tubulin in the cytoskeleton, has a high affinity for calcium, is the binding target for the antimalarial compound artemisinin, and is induced in vitamin D-dependent apoptosis. TPT1 production is thought to be controlled at the translational as well as the transcriptional level.

Références
  • Thaw P. et al., 2001, Nat Struct Biol. 8 (8): 701-4.
  • Thiele H. et al., 2000, Eur J Biochem. 267 (17): 5473-81.
  • Chitpatima ST. et al., 1988, Nucleic Acids Res. 16 (5): 2350.
  • Size / Price
    Catalogue : MG51648-CM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »