After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse TUBB3 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_023279.2
Taille du ADNc:1353bp
Description du ADNc:Full length Clone DNA of Mus musculus tubulin, beta 3 with C terminal His tag.
Synonyme du gène:M(beta)3, M(beta)6, 3200002H15Rik, Tubb3
Espèces:Mouse
Vecteur:pCMV3-C-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur on other vectors
Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurMG51063-ACGCHF270
Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurMG51063-ACRCHF270
Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurMG51063-ANGCHF270
Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurMG51063-ANRCHF270
Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurMG51063-CFCHF230
Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurMG51063-CHCHF230
Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurMG51063-CMCHF230
Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurMG51063-CYCHF230
Souris TUBB3 / beta III Tubulin Gène ADNc clone le vecteur de clonageMG51063-GCHF90
Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurMG51063-NFCHF230
Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurMG51063-NHCHF230
Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurMG51063-NMCHF230
Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurMG51063-NYCHF230
Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF cloneMG51063-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : MG51063-CH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
Images
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »