Commande rapide

Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Souris TUBB3 Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:NM_023279.2
    Taille du ADNc:1353bp
    Description du ADNc:Full length Clone DNA of Mus musculus tubulin, beta 3 with C terminal His tag.
    Synonyme du gène:M(beta)3, M(beta)6, 3200002H15Rik, Tubb3
    Espèces:Mouse
    Vecteur:pCMV3-C-His
    Plasmid:
    Site de restriction:
    Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TUBB3 qPCR primers for gene expression analysis, MP201020 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur on other vectors
    Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurMG51063-ACGCHF270
    Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurMG51063-ACRCHF270
    Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurMG51063-ANGCHF270
    Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurMG51063-ANRCHF270
    Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurMG51063-CFCHF230
    Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurMG51063-CHCHF230
    Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurMG51063-CMCHF230
    Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurMG51063-CYCHF230
    Souris TUBB3 / beta III Tubulin Gène ADNc clone le vecteur de clonageMG51063-GCHF90
    Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurMG51063-NFCHF230
    Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurMG51063-NHCHF230
    Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurMG51063-NMCHF230
    Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurMG51063-NYCHF230
    Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF cloneMG51063-UTCHF230
     En savoir plus sur les vecteurs d'expression
    Product nameProduct name
    Size / Price
    Catalogue : MG51063-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »