After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse TUBB3 Informations sur les produits clonés de cDNA
Taille du ADNc:1353bp
Description du ADNc:Full length Clone DNA of Mus musculus tubulin, beta 3 with N terminal Flag tag.
Synonyme du gène:M(beta)3, M(beta)6, 3200002H15Rik, Tubb3
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur on other vectors
Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurMG51063-ACGCHF270
Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurMG51063-ACRCHF270
Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurMG51063-ANGCHF270
Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurMG51063-ANRCHF270
Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurMG51063-CFCHF234
Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurMG51063-CHCHF234
Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurMG51063-CMCHF234
Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurMG51063-CYCHF234
Souris TUBB3 / beta III Tubulin Gène ADNc clone le vecteur de clonageMG51063-GCHF90
Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurMG51063-NFCHF234
Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurMG51063-NHCHF234
Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurMG51063-NMCHF234
Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurMG51063-NYCHF234
Souris TUBB3 / beta III Tubulin expression plasmide de Gène l'ADNc ORF cloneMG51063-UTCHF234
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : MG51063-NF
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.