Commande rapide

Souris TrkB/NTRK2 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Souris NTRK2 Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:NM_001025074.1
    Taille du ADNc:2466bp
    Description du ADNc:Full length Clone DNA of Mus musculus neurotrophic tyrosine kinase, receptor, type 2, transcript variant 1 with N terminal His tag.
    Synonyme du gène:Tkrb, trkB, AI848316, C030027L06Rik
    Espèces:Mouse
    Vecteur:pCMV3-SP-N-His
    Plasmid:
    Site de restriction:
    Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with NTRK2 qPCR primers for gene expression analysis, MP200162 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Souris TrkB/NTRK2 transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur on other vectors
    Product nameProduct name
    Fond

    TrkB receptor also known as TrkB tyrosine kinase or BDNF/NT-3 growth factors receptor or neurotrophic tyrosine kinase, receptor, type 2 (NTRK2) is a single transmembrane catalytic receptors with intracellular tyrosine kinase activity. TrkB/NTRK2 is a member of the neurotrophic tyrosine receptor kinase (NTRK) family. TrkB tyrosine kinase (TrkB) or NTRK2 is coupled to the Ras, Cdc42/Rac/RhoG, MAPK, PI3-K and PLCgamma signaling pathways. There are four members of the Trk family; TrkA, TrkB and TrkC and a related p75NTR receptor. Each family member binds different neurotrophins with varying affinities. TrkB/NTRK has highest affinity for brain-derived neurotrophic factor (BDNF) and is involved in neuronal plasticity, longterm potentiation and apoptosis of CNS neurons. Other neurotrophins include nerve growth factor(NGF), neurotrophin-3 and neurotrophin-4. TrkB/NTRK is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation. Mutations in TrkB/NTRK have been associated with obesity and mood disorders.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    Références
  • Klein R, et al. (1990) The trkB tyrosine protein kinase gene codes for a second neurogenic receptor that lacks the catalytic kinase domain. Cell. 61 (4): 647-56.
  • Rose CR, et al. (2003) Truncated TrkB-T1 mediates neurotrophin-evoked calcium signalling in glia cells. Nature. 426 (6962): 74-8.
  • Yamada K, et al. (2004) Brain-derived neurotrophic factor/TrkB signaling in memory processes. J Pharmacol Sci. 91 (4): 267-70.
  • Size / Price
    Catalogue : MG50132-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »