Commande rapide

Souris USP5 expression plasmide de Gène l'ADNc ORF clone

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Souris USP5 Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:AK154008.1
    Taille du ADNc:2508bp
    Description du ADNc:Full length Clone DNA of Mus musculus ubiquitin specific peptidase 5 (isopeptidase T).
    Synonyme du gène:ISOT, Ucht, ISOT-1, AA407472
    Espèces:Mouse
    Vecteur:pCMV3-untagged
    Plasmid:
    Site de restriction:
    Séquence du marqueur:
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with USP5 qPCR primers for gene expression analysis, MP201244 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    Fond

    Ubiquitin carboxyl-terminal hydrolase 5, also known as Deubiquitinating enzyme 5, Isopeptidase T, Ubiquitin thiolesterase 5, Ubiquitin-specific-processing protease 5, ISOT and USP5, is a member of the peptidase C19 family. USP5 contains 2 UBA domains and one UBP-type zinc finger. The UBP-type zinc finger domain interacts selectively with an unmodified C-terminus of the proximal ubiquitin. Both UBA domains are involved in polyubiquitin recognition. The UBP-type zinc finger domain crystallizes as a dimer linked by a disulfide bond between the Cys-195 residues of both molecules, but there is no evidence that the full-length USP5 exists as a dimer. USP5 cleaves linear and branched multiubiquitin polymers with a marked preference for branched polymers. USP5 is involved in unanchored 'Lys-48'-linked polyubiquitin disassembly. It binds linear and 'Lys-63'-linked polyubiquitin with a lower affinity. Knock-down of USP5 causes the accumulation of p53/TP53 and an increase in p53/TP53 transcriptional activity because the unanchored polyubiquitin that accumulates is able to compete with ubiquitinated p53/TP53 but not with MDM2 for proteasomal recognition.

    Références
  • Reyes-Turcu F.E., et al., 2006, Cell 124:1197-1208.
  • Reyes-Turcu F.E., et al., 2008, J. Biol. Chem. 283:19581-19592.
  • Dayal S., et al., 2009, J. Biol. Chem. 284:5030-5041.
  • Burkard T.R., et al., 2011, BMC Syst. Biol. 5:17-17.
  • Size / Price
    Catalogue : MG51371-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »