After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Souris USP5 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse USP5 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:AK154008.1
Taille du ADNc:2508bp
Description du ADNc:Full length Clone DNA of Mus musculus ubiquitin specific peptidase 5 (isopeptidase T).
Synonyme du gène:ISOT, Ucht, ISOT-1, AA407472
Espèces:Mouse
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Fond

Ubiquitin carboxyl-terminal hydrolase 5, also known as Deubiquitinating enzyme 5, Isopeptidase T, Ubiquitin thiolesterase 5, Ubiquitin-specific-processing protease 5, ISOT and USP5, is a member of the peptidase C19 family. USP5 contains 2 UBA domains and one UBP-type zinc finger. The UBP-type zinc finger domain interacts selectively with an unmodified C-terminus of the proximal ubiquitin. Both UBA domains are involved in polyubiquitin recognition. The UBP-type zinc finger domain crystallizes as a dimer linked by a disulfide bond between the Cys-195 residues of both molecules, but there is no evidence that the full-length USP5 exists as a dimer. USP5 cleaves linear and branched multiubiquitin polymers with a marked preference for branched polymers. USP5 is involved in unanchored 'Lys-48'-linked polyubiquitin disassembly. It binds linear and 'Lys-63'-linked polyubiquitin with a lower affinity. Knock-down of USP5 causes the accumulation of p53/TP53 and an increase in p53/TP53 transcriptional activity because the unanchored polyubiquitin that accumulates is able to compete with ubiquitinated p53/TP53 but not with MDM2 for proteasomal recognition.

Références
  • Reyes-Turcu F.E., et al., 2006, Cell 124:1197-1208.
  • Reyes-Turcu F.E., et al., 2008, J. Biol. Chem. 283:19581-19592.
  • Dayal S., et al., 2009, J. Biol. Chem. 284:5030-5041.
  • Burkard T.R., et al., 2011, BMC Syst. Biol. 5:17-17.
  • Size / Price
    Catalogue : MG51371-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »