VANGL2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Price:
Size:
Number:

VANGL2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1566 bp
Description
Full length Clone DNA of Mouse vang-like 2 (van gogh, Drosophila) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

VANGL2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag: Alternative Names

C530001F03Rik cDNA ORF Clone, Mouse; loop-tail cDNA ORF Clone, Mouse; Lp cDNA ORF Clone, Mouse; Lpp1 cDNA ORF Clone, Mouse; Ltap cDNA ORF Clone, Mouse; m17Jus&gt cDNA ORF Clone, Mouse; ska&lt cDNA ORF Clone, Mouse; ska17 cDNA ORF Clone, Mouse; stbm cDNA ORF Clone, Mouse; strabismus cDNA ORF Clone, Mouse; Vang1l2 cDNA ORF Clone, Mouse
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait