VPS45 cDNA ORF Clone, Mouse, N-HA tag

Price:
Size:
Number:

VPS45 cDNA ORF Clone, Mouse, N-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1713 bp
Description
Full length Clone DNA of Mouse vacuolar protein sorting 45 (yeast) with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

VPS45 cDNA ORF Clone, Mouse, N-HA tag: Alternative Names

AI462172 cDNA ORF Clone, Mouse; AW554165 cDNA ORF Clone, Mouse; mVps45 cDNA ORF Clone, Mouse

VPS45 Background Information

Full Name
vacuolar protein sorting 45 homolog (S. cerevisiae)
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait