WBSCR22 cDNA ORF Clone, Mouse, C-Myc tag

Price:
Size:
Number:

WBSCR22 cDNA ORF Clone, Mouse, C-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
846 bp
Description
Full length Clone DNA of Mouse Williams Beuren syndrome chromosome region 22 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

WBSCR22 cDNA ORF Clone, Mouse, C-Myc tag: Alternative Names

1110003N24Rik cDNA ORF Clone, Mouse

WBSCR22 Background Information

Full Name
Williams Beuren syndrome chromosome region 22
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait