Commande rapide

Souris WTAP expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse WTAP Informations sur les produits clonés de cDNA
Taille du ADNc:456bp
Description du ADNc:Full length Clone DNA of Mus musculus Wilms tumour 1-associating protein with C terminal Flag tag.
Synonyme du gène:2810408K05Rik, 9430038B09Rik
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Wilms' tumor 1-associating protein (WTAP) was previously identified as a protein associated with Wilms' tumor-1 (WT-1) protein that is essential for the development of the genitourinary system. WT1 was originally identified as a tumor suppressor for Wilms' tumor, but it is also overexpressed in a variety of cancer cells. The WTAP-WT1 axis in vascular cells suggest that WTAP is a vital and multifaceted regulator of vascular remodeling. WTAP has been suggested to function in alternative splicing, stabilization of mRNA, and cell growth. Knocking down endogenous WTAP increased Smooth muscle cells (SMCs) proliferation, because of increased DNA synthesis and G(1)/S phase transition, together with reduced apoptosis. These effects could be the result of WTAP suppressing the transcriptional activity of WT1 in SMCs. WTAP may thus also play a role in messenger RNA processing in mammalian cells, either dependent on or independent of its interaction with WT1.

  • Fukusumi Y, et al. (2008) Wtap is required for differentiation of endoderm and mesoderm in the mouse embryo. Dev Dyn. 237(3): 618-29.
  • Small TW, et al. (2007) Vascular biology and the sex of flies: regulation of vascular smooth muscle cell proliferation by wilms' tumor 1-associating protein. Trends Cardiovasc Med. 17(7): 230-4.
  • Small TW, et al. (2006) Wilms' tumor 1-associating protein regulates the proliferation of vascular smooth muscle cells. Circ Res. 99(12): 1338-46.
  • Rong Y, et al. (2006) Wilms' tumor 1 and signal transducers and activators of transcription 3 synergistically promote cell proliferation: a possible mechanism in sporadic Wilms' tumor. Cancer Res. 66(16): 8049-57.
  • Size / Price
    Catalogue : MG52198-CF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.